View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1297_high_73 (Length: 284)

Name: NF1297_high_73
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1297_high_73
NF1297_high_73
[»] chr3 (1 HSPs)
chr3 (30-228)||(47661693-47661882)


Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 30 - 228
Target Start/End: Complemental strand, 47661882 - 47661693
Alignment:
30 gattgccatggagatcaggagaatattagaggaatgtttgatgagaaggactcttgcagctcatgtagattatatctatactcagaaaatcatatcatcc 129  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||    
47661882 gattgccatggagatcaggagaatattagaggaatgtttgatgagaaggactcttgcagct---------tatatctatactcagaaaatcatatcatcc 47661792  T
130 atggaatgacaatccatcacatgcatttagaatccaaataacttaataatataaataaatcaaagttataaacaagtaaaaaacatattgtccctatag 228  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47661791 atggaatgacaatccatcacatgcatttagaatccaaataacttaataatataaataaatcaaagttataaacaagtaaaaaacatattgtccctatag 47661693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University