View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_high_8 (Length: 566)
Name: NF1297_high_8
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 91; Significance: 8e-44; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 327 - 421
Target Start/End: Complemental strand, 9692714 - 9692620
Alignment:
| Q |
327 |
atatgtctcgagcataccttccatgatgaactagaaatccttgtgcttttatcttaaattccatttctatgaaataagataagataccaagatca |
421 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9692714 |
atatgtctcgagcataccttccatgatgaactagaaatccttgtgctcttatcttaaattccatttctatgaaataagataagataccaagatca |
9692620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 31 - 116
Target Start/End: Complemental strand, 9692828 - 9692743
Alignment:
| Q |
31 |
cttatttgagcaccatgacattgtttcattcccataaatgaacacatatacaacaatgttttttctatcacttttgtctctgctca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9692828 |
cttatttgagcaccatgacattgtttcattcccataaatgaacacatatacaacaatgttttttctatcacttttgtctctgctca |
9692743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 473 - 554
Target Start/End: Complemental strand, 9692622 - 9692542
Alignment:
| Q |
473 |
tcattgttgccggtcacaatcatgtcaccaacatatttagcttacaattagtttgtgcttatttgttgagtttttgcagtat |
554 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9692622 |
tcattgttgccggtcacaatcacgtcaccaacatatt-agcttacaattagtttgtgcttatttgttgagtttttgcagtat |
9692542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University