View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_high_80 (Length: 275)
Name: NF1297_high_80
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_high_80 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 13 - 247
Target Start/End: Complemental strand, 32260400 - 32260166
Alignment:
| Q |
13 |
aatatccaagaactaaatcccatgattgagacttttaattcaggagtgtgttcccccactatacggtgtgatactatgaagaaaaattgtatacagtcat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32260400 |
aatatccaagaactaaatcccatgattgagagttttaattcaggagtgtgttcccccactatacggtgtgatactatgaagaaaaattgtatacagtcat |
32260301 |
T |
 |
| Q |
113 |
tgagtgtggctgcagacagtgcaatctgtcctaattcagttgctatgaggttaagttctatcaaagcatcggacactgcagggaaattactgaatgctat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32260300 |
tgagtgtggctgcagacagtgcaatctgtcctaattcagttgctatgaggttaagttctatcaaagcatcggacactgcagggaaattactgaatgctat |
32260201 |
T |
 |
| Q |
213 |
cgtagcacttaatgctgtacgcgaagcttctattt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32260200 |
cgtagcacttaatgctgtacgcgaagcttctattt |
32260166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University