View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_high_81 (Length: 274)
Name: NF1297_high_81
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_high_81 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 13 - 245
Target Start/End: Original strand, 2871440 - 2871672
Alignment:
| Q |
13 |
aatatgctgaagagaaaagagcaatagttgaggctcaaaaaagggaagaatgtcttgagctagaggaaacagctgcaaagtttcgtagtcgtggagttgc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2871440 |
aatatgctgaagagaaaagagcaatagttgaggctcaaaaaagggaagaatgtcttgaactagaggaaacagctgcaaagtttcgtagtcgtggagttgc |
2871539 |
T |
 |
| Q |
113 |
accaaagaaattgtttggatgctttagtgcttaagnnnnnnnnaagtcaaataagaagaattgaattcttgatggattggttttacatgatgttcaatta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2871540 |
accaaagaaattgtttggatgctttagtgcttaagttttttttaagccaaataagaagaattgaattcttgatggattggttttacatgatgttcaatta |
2871639 |
T |
 |
| Q |
213 |
tgtatacttttaaaagtgtggttttgttcttat |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2871640 |
tgtatacttttaaaagtgtggttttgttcttat |
2871672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 76 - 121
Target Start/End: Original strand, 2876565 - 2876610
Alignment:
| Q |
76 |
aggaaacagctgcaaagtttcgtagtcgtggagttgcaccaaagaa |
121 |
Q |
| |
|
|||||||| |||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
2876565 |
aggaaacatctgctaagtttcgtagccgtggagttgcaccaaagaa |
2876610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University