View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1297_high_83 (Length: 266)

Name: NF1297_high_83
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1297_high_83
NF1297_high_83
[»] chr2 (1 HSPs)
chr2 (18-220)||(41830406-41830608)


Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 41830608 - 41830406
Alignment:
18 catctccaacaatattgcaaaacacaattttcaataccatgaatattgacacgttgcctatgatggatcatagtggatacttcaacaatacagttactac 117  Q
    |||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
41830608 catcaccatcaatattgcaaaacacaattttcaataccatgaatattgacacgttgcctgtgatggatcatagtggatacttcaacaatacagttactac 41830509  T
118 aatgccatgcttttcgtcacaaaatcatgaagttgaaattaaaggttcttatttagaaaatggtgtgtttgggagtgtaaatattggagtagaaggggat 217  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41830508 aatgccatgcttttcgtcacaaaatcacgaagttgaaattaaaggttcttatttagaaaatggtgtgtttgggagtgtaaatattggagtagaaggggat 41830409  T
218 atg 220  Q
    |||    
41830408 atg 41830406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University