View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_high_94 (Length: 252)
Name: NF1297_high_94
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_high_94 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 68 - 231
Target Start/End: Original strand, 51766969 - 51767132
Alignment:
| Q |
68 |
aacaacaattttttgatgaattttgggtgtaaattagagagcatatataagactagtattggtgatgatatttgaactcggactcttaacaaatccggtc |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
51766969 |
aacaacaattttttgatgaattttgggtgtaaattagagagcatatataagactagtattggtgatgatatttgaactcggactcttgacaaatccggtc |
51767068 |
T |
 |
| Q |
168 |
ttttctcttttaagtttttatatggggctcttgnnnnnnngttcttatcggtttcaacttttct |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
51767069 |
ttttctcttttaagtttttatatggggctcttgaaaaaaagttattatcggtttcaacttttct |
51767132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 33 - 69
Target Start/End: Original strand, 51766834 - 51766870
Alignment:
| Q |
33 |
taaaacatgagacactttaagaaatgaaaactagaaa |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51766834 |
taaaacatgagacactttaagaaatgaaaactagaaa |
51766870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 51766883 - 51766920
Alignment:
| Q |
1 |
aatgagatgattaatatgttgatccaaaaatctaaaac |
38 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
51766883 |
aatgagatgattaatatgttgctccaaaaatctaaaac |
51766920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University