View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_high_99 (Length: 251)
Name: NF1297_high_99
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_high_99 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 98 - 247
Target Start/End: Complemental strand, 25466887 - 25466738
Alignment:
| Q |
98 |
ggtgcgaagaatgtgattattgcttgcagagaatctaaagtgaaacgcttaatatacaatagttctgctgatgttgtgtttgatagagataaaccgttgg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25466887 |
ggtgcgaagaatgtgattattgcttgcagagaatctaaagtgaaacgcttaatatacaatagttctgctgatgttgtgtttgatagagataaaccgttgg |
25466788 |
T |
 |
| Q |
198 |
cgtatccgtggaaagtgagattttctttaagtttgtttcctttgcttctt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25466787 |
cgtatccgtggaaagtgagattttctttaagtttgtttcctttgtttctt |
25466738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 25466984 - 25466956
Alignment:
| Q |
1 |
tttgtataagctaatagttcaaggtactc |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25466984 |
tttgtataagctaatagttcaaggtactc |
25466956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University