View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_low_100 (Length: 267)
Name: NF1297_low_100
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_low_100 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 4e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 46 - 227
Target Start/End: Complemental strand, 6141378 - 6141206
Alignment:
| Q |
46 |
gatagtccacttcttatctaagcaaaaataaacactgaccttccaaattatagtaacttcatgttcccgtttannnnnnnnnnnnnnnnnnaggaattca |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6141378 |
gatagtccacttcttatctaagcaaaaataaacactgaccttctaaattatagtaacttcatgttcccgttta---------ttttttgttaggaattca |
6141288 |
T |
|
| Q |
146 |
tgttcaacttttatatgtgtgtcgaacaatattatgagttaattaatactttnnnnnnnntgtaatctttttatcaaggaac |
227 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6141287 |
tgttcaacttttatatgtgtgtctaacaatattatgagttaattaatactttaaaaaaaatgtaatctttttatcaaggaac |
6141206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University