View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_low_101 (Length: 266)
Name: NF1297_low_101
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_low_101 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 41830608 - 41830406
Alignment:
| Q |
18 |
catctccaacaatattgcaaaacacaattttcaataccatgaatattgacacgttgcctatgatggatcatagtggatacttcaacaatacagttactac |
117 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41830608 |
catcaccatcaatattgcaaaacacaattttcaataccatgaatattgacacgttgcctgtgatggatcatagtggatacttcaacaatacagttactac |
41830509 |
T |
|
| Q |
118 |
aatgccacgcttttcgtcacaaaatcatgaagttgaaattaaaggttcttatttagaaaatggtgtgtttgggagtgtaaatattggagtagaaggggat |
217 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41830508 |
aatgccatgcttttcgtcacaaaatcacgaagttgaaattaaaggttcttatttagaaaatggtgtgtttgggagtgtaaatattggagtagaaggggat |
41830409 |
T |
|
| Q |
218 |
atg |
220 |
Q |
| |
|
||| |
|
|
| T |
41830408 |
atg |
41830406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University