View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_low_104 (Length: 265)
Name: NF1297_low_104
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_low_104 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 30 - 255
Target Start/End: Original strand, 47933868 - 47934093
Alignment:
| Q |
30 |
ggttgagggtttcgtcattgttagtgctactacctcgccattacccctgacagttattttcgaatataccagttttgatgcaatggtaaagttgctgtca |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
47933868 |
ggttgagggtttcgtcattgttagtgctactacctcgccaatacccctgacagttattttcgaatataccagctttgatgcaatggtaaagttgttgtca |
47933967 |
T |
|
| Q |
130 |
cgtaactaaaagggtatttaggtcttgagaacaccctctggtgtaaacaacacggaagcagcgcacaatataccaattgattggacccccttcctagaac |
229 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47933968 |
cgtaactaaaaaggtatttaagtcttgagaacaccctctggtgtaaacatcacggaagcagcgcacaatataccaattgattggacccccttcctagaac |
47934067 |
T |
|
| Q |
230 |
ggctcatttactagaacggctctctg |
255 |
Q |
| |
|
|||||||||||||||| ||||||||| |
|
|
| T |
47934068 |
ggctcatttactagaatggctctctg |
47934093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University