View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1297_low_108 (Length: 256)

Name: NF1297_low_108
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1297_low_108
NF1297_low_108
[»] chr2 (2 HSPs)
chr2 (173-241)||(38205518-38205586)
chr2 (34-81)||(38205727-38205774)
[»] chr7 (2 HSPs)
chr7 (173-233)||(2988808-2988868)
chr7 (38-78)||(3127667-3127707)
[»] chr5 (1 HSPs)
chr5 (38-89)||(12323781-12323832)


Alignment Details
Target: chr2 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 173 - 241
Target Start/End: Complemental strand, 38205586 - 38205518
Alignment:
Q  173 ttgctactgaaacttataatgttttattttgaaatgcatggtgatcatatgtactcagacctgcctatg 241  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||    
T  38205586 ttgctactgaaacttataatgttttattttgaaatgcatggtgatcatatgtattcagacctacctatg 38205518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 34 - 81
Target Start/End: Complemental strand, 38205774 - 38205727
Alignment:
Q  34 tcaattggagttaactattatcaatatgaagttgtgatattgtttgct 81  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||    
T  38205774 tcaattgaagttaactattatcaatatgaagttgtgatattgtttgct 38205727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 173 - 233
Target Start/End: Original strand, 2988808 - 2988868
Alignment:
Q  173 ttgctactgaaacttataatgttttattttgaaatgcatggtgatcatatgtactcagacc 233  Q
    |||||| |||||||||||||  ||||||||||||| | | |||||||||||||||||||||    
T  2988808 ttgctattgaaacttataattgtttattttgaaatacctagtgatcatatgtactcagacc 2988868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 78
Target Start/End: Complemental strand, 3127707 - 3127667
Alignment:
Q  38 ttggagttaactattatcaatatgaagttgtgatattgttt 78  Q
    ||||||||||||||| |||| |||||||| |||||||||||    
T  3127707 ttggagttaactattgtcaagatgaagttctgatattgttt 3127667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 38 - 89
Target Start/End: Original strand, 12323781 - 12323832
Alignment:
Q  38 ttggagttaactattatcaatatgaagttgtgatattgtttgctcctatgat 89  Q
    ||||||||||||||| |||  |||||||||||||||||||| ||||||||||    
T  12323781 ttggagttaactattgtcaccatgaagttgtgatattgttttctcctatgat 12323832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University