View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_low_116 (Length: 253)
Name: NF1297_low_116
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_low_116 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 47654065 - 47653819
Alignment:
| Q |
1 |
atatgagtcttctcttgtatatatccgacattaaattcattcatatgttgatacgagactaatcactcacacttgaagtcaacaatcttccctcaagtgt |
100 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47654065 |
atatgagtcttctcttgcatatatctgacattaaattcattcatatgttgatacgagactaatcactcacacttgaagtcaacaatcttccctcaagtgt |
47653966 |
T |
|
| Q |
101 |
ggagctatatccaatacttgcatcaccattattaccggcataataacatgtctcctgactacactaacatgaagacttttgtagcaagtccaaacattga |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47653965 |
ggacctatatccaatacttgcatcaccattattaccggcataataacatgtcttctgactacactaacatgaagacttttgtagcaagtccaaacattga |
47653866 |
T |
|
| Q |
201 |
gatattcaatttcgctctctcaccaattaaaacttggcctatgatac |
247 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
47653865 |
gatattcactttcgctctctcgccaattaaaacttggcctttgatac |
47653819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University