View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_low_117 (Length: 252)
Name: NF1297_low_117
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_low_117 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 19571940 - 19572164
Alignment:
| Q |
1 |
gtgaaggacagggttccctaatttaagagaagcgcacatatttttgcattaagatcagacaacttagattacgcaacaacaaaatcaattttaaaccgtc |
100 |
Q |
| |
|
||||||||| |||||||||||| |||||||||| ||||||||| ||||||||||||||| |||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
19571940 |
gtgaaggacggggttccctaatctaagagaagcacacatatttatgcattaagatcagaaaacttagattacgcaataacaaaatcaattttaaaccatc |
19572039 |
T |
 |
| Q |
101 |
tctgatnnnnnnnnn-tcaactttaaactatctttgccattgattaagatcgaccggttgaaattgaaaaccggagttgtaatgtttaagagaccannnn |
199 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19572040 |
tctgataaaaaaaaaatcaactttaaactatctttgccattgattaagatcgaccggttgaaattgaaaaccggagttgtaatgtttaagagaccatttt |
19572139 |
T |
 |
| Q |
200 |
nnncgacaaattgtgacatgccatt |
224 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
19572140 |
tttcgacaaattgtgacatgccatt |
19572164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University