View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_low_124 (Length: 251)
Name: NF1297_low_124
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_low_124 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 139 - 246
Target Start/End: Complemental strand, 43585813 - 43585706
Alignment:
| Q |
139 |
aacaaaaaatttatacaataaggtaatgttaaatctttaacttgatcattttataataaagtaagggacatgtcttttcttttgaaagataaaaggcttc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43585813 |
aacaaaaaatttatacaataaggtaatgttaaatctttaacttgatcattttataataaagtaagggacatgtcttttcttttgaaagataaaaggcttc |
43585714 |
T |
|
| Q |
239 |
atctcact |
246 |
Q |
| |
|
|| ||||| |
|
|
| T |
43585713 |
atttcact |
43585706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 43585968 - 43585875
Alignment:
| Q |
1 |
gcttgagtacccatatactataattaattggatactattttgctgcttnnnnnnnnntacatattatgattatagctgtattaatatgattaaaa |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| ||||| ||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
43585968 |
gcttgagtacccatatactataattaattgcatactattttggtgctt-aaaaaaaatacattttatgattatagctatattaatatgattaaaa |
43585875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University