View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_low_129 (Length: 251)
Name: NF1297_low_129
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_low_129 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 1712605 - 1712710
Alignment:
| Q |
1 |
ttaattgagttgatataccataaataagagaatattaataaaaataatgtcattagtattttattaataaatcatgtctaatatgaacacaaaaggattg |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1712605 |
ttaattgagttgatatacaataaataagagaatattaataaaaataatgtcattagtattttattaataaatcatgtctaatatgaacacgaaaggattg |
1712704 |
T |
|
| Q |
101 |
tgatat |
106 |
Q |
| |
|
|||||| |
|
|
| T |
1712705 |
tgatat |
1712710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 1713187 - 1713306
Alignment:
| Q |
123 |
tcagactcgaagccaacaatcaaattaatctaaaagacaattaattaataattgacaccatcatactccgattgtttggaatattcaagagcccgtctca |
222 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
1713187 |
tcagactcgaagccaacgatcaagctaatctaagagacaattaattaatgattgacaccatcatactccgattgtttgaaatattcaagagctcgtctca |
1713286 |
T |
|
| Q |
223 |
gggaatttgcaagttcatct |
242 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
1713287 |
aggaatttgcaagttcatct |
1713306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University