View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1297_low_131 (Length: 250)

Name: NF1297_low_131
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1297_low_131
NF1297_low_131
[»] chr3 (2 HSPs)
chr3 (30-219)||(44767048-44767237)
chr3 (31-80)||(44756956-44757005)
[»] chr1 (1 HSPs)
chr1 (30-72)||(23256258-23256300)


Alignment Details
Target: chr3 (Bit Score: 154; Significance: 9e-82; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 30 - 219
Target Start/End: Original strand, 44767048 - 44767237
Alignment:
30 gttctcaaaactattgattttgggctgtctgttttttataagccaggtttggaattctttttcctttctatttctattttgatcaatatgtgaagtgatg 129  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |  ||||||||||||||||||||||||||||||||||||||||||||||    
44767048 gttctcaaaactattgattttgggctgtctgttttttataagccaggtttagttttctttttcctttctatttctattttgatcaatatgtgaagtgatg 44767147  T
130 aatgattttataatgttttcacatctggggcaatgttcagatgcgacggtttttatcatgatggaattctttttgttcaaattaattgat 219  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||   |||||||||||||||||||| |||||||||||||||||||||    
44767148 aatgatcttataatgttttcacatctagggcaatgttcagatgcggtcgtttttatcatgatggaattttttttgttcaaattaattgat 44767237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 80
Target Start/End: Original strand, 44756956 - 44757005
Alignment:
31 ttctcaaaactattgattttgggctgtctgttttttataagccaggtttg 80  Q
    ||||||||||||||||||||||  ||||||||||||| ||||||||||||    
44756956 ttctcaaaactattgattttggtttgtctgttttttacaagccaggtttg 44757005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 72
Target Start/End: Complemental strand, 23256300 - 23256258
Alignment:
30 gttctcaaaactattgattttgggctgtctgttttttataagc 72  Q
    |||||||||||||||||||||||  ||| ||||||||||||||    
23256300 gttctcaaaactattgattttggaatgtttgttttttataagc 23256258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University