View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_low_132 (Length: 250)
Name: NF1297_low_132
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_low_132 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 16 - 173
Target Start/End: Complemental strand, 13348691 - 13348534
Alignment:
| Q |
16 |
atgatcgtttcattgatatgatggaaaactacttctcagctcctcatgacttcaagattcgccaagagagacctcatttgcattaccaggttcattaatc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13348691 |
atgatcgtttcattgatatgatggaaaactacttctcagctcctcatgagttcaagattcgtcaagagagacctcatttgcattaccaggttcattaatc |
13348592 |
T |
|
| Q |
116 |
gtttcacttatttactagtttaaattgaaattagagtttaattactgtataatgtata |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13348591 |
gtttcacttatttactagtttaaattgaaattagagtttaattactgtataatgtata |
13348534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 172 - 250
Target Start/End: Complemental strand, 13348351 - 13348273
Alignment:
| Q |
172 |
taggttggggttacgccggagagagtggaagtgccgagaagtttggtggatgaagaaatgcaagagaaagtgaaagaaa |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13348351 |
taggttggggttacgccggagagagtggaagtaccgagaagtttggtggatgaagaaatgcaagagaaagtgaaagaaa |
13348273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University