View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_low_134 (Length: 249)
Name: NF1297_low_134
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_low_134 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 138 - 225
Target Start/End: Complemental strand, 33570698 - 33570611
Alignment:
| Q |
138 |
ctgtgtttggctgtacaaaatacaaagttcatgttttcagcccctcaaaacagatcaaaagatgaaaaaatgaagattactatttgct |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33570698 |
ctgtgtttggctgtacaaaatacaaagttcatgttttcagcccctcaaaacagatcaaaagatgaaaaaatgaagattactatttgct |
33570611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 29 - 115
Target Start/End: Complemental strand, 33570809 - 33570723
Alignment:
| Q |
29 |
gtaaaacaagcaaatgcagtgctatacttataacaaattgaacaaatgtcggtgtaccttgaaaactaaatatcctagtcatgaacc |
115 |
Q |
| |
|
|||||||||||| || ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33570809 |
gtaaaacaagcagattcagtgctatacttattacaaattgaacaaatgtcggtgtaccttgaaaactaaatatcctagtcatgaacc |
33570723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University