View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_low_144 (Length: 228)
Name: NF1297_low_144
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_low_144 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 7 - 228
Target Start/End: Complemental strand, 20928528 - 20928307
Alignment:
| Q |
7 |
tctcctacaccaaactttttcccacttgattaccaacaacaggcataaccttatcagcattaggggattgaaagtgcttgcatctttgttgttactttga |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20928528 |
tctcctacaccaaactttttcccacttgattaccaacaacaggcatagccttatcagcattaggggattgaaagtgcttgcatctttgttgctactttga |
20928429 |
T |
|
| Q |
107 |
actatcttgcctatcttcttacaaagatgaatcgtgtccaatttgcttaccattggaacaaaaaagaggttgtttttgatatcgcacatccacataaaag |
206 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
20928428 |
actatcttgcctatcttcttacaaacatgaatcgtgtccaatttgcttaccattggaacaaaaaagaggttgtttttcatatcgcgcatccacataaaag |
20928329 |
T |
|
| Q |
207 |
gcataaccatcacgttctacca |
228 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
20928328 |
gcataaccatcacgttctacca |
20928307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University