View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_low_25 (Length: 451)
Name: NF1297_low_25
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 3e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 12 - 196
Target Start/End: Original strand, 32277809 - 32277993
Alignment:
| Q |
12 |
ataggtaacgtttctccttagattgagaaatattctgaggttgaatttgtaaaatcaggttcgtttcttcttttcagatcgtagaaattatcattttgtg |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||| ||||| ||||||||||||||||||||||||||||||||||| ||||| | ||||||| ||| |
|
|
| T |
32277809 |
atagataacgtttctccttagattgagaaatagcctggggttgtctttgtaaaatcaggttcgtttcttcttttcagatcttagaactaatcatttcgtg |
32277908 |
T |
 |
| Q |
112 |
ttttattgttttcaatggtcctattttcataccgtcactgtttctgcaaattttaactctgtcagttttgtaatcaactttggtt |
196 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
32277909 |
ttttattgttttcaatggtcctatttccataccgtcgttgtttctgcaaattttaactctgtcaatttagtaatcaactttggtt |
32277993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 363 - 402
Target Start/End: Original strand, 12873724 - 12873763
Alignment:
| Q |
363 |
taaccatatggttatgattatattttgatattgatactat |
402 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12873724 |
taaccttatggttatgattatattttgatattgatactat |
12873763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 364 - 402
Target Start/End: Original strand, 27770875 - 27770913
Alignment:
| Q |
364 |
aaccatatggttatgattatattttgatattgatactat |
402 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27770875 |
aaccttatggttatgattatattttgatattgatactat |
27770913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 256 - 317
Target Start/End: Original strand, 13765127 - 13765188
Alignment:
| Q |
256 |
aaaatattcattttgtatgaactatattaggattatgg-cgtgtgtacgggctgctgctatat |
317 |
Q |
| |
|
||||||||||||| ||||||||| || |||||| ||| |||||||||||||||||||||||| |
|
|
| T |
13765127 |
aaaatattcattt-gtatgaactgcatgaggattgtggtcgtgtgtacgggctgctgctatat |
13765188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 195 - 228
Target Start/End: Complemental strand, 14863795 - 14863762
Alignment:
| Q |
195 |
ttgatttgatttttggctataatggagtaatacg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
14863795 |
ttgatttgatttttggctataatggagtcatacg |
14863762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University