View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1297_low_44 (Length: 373)

Name: NF1297_low_44
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1297_low_44
NF1297_low_44
[»] chr3 (2 HSPs)
chr3 (80-239)||(52443720-52443879)
chr3 (249-278)||(52443895-52443924)


Alignment Details
Target: chr3 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 80 - 239
Target Start/End: Original strand, 52443720 - 52443879
Alignment:
80 ctgttgcaaaaatattgaattttttcaaataactcaacataatcattgttaccaatgtagtcagaaatactggtgatgccagacaaacccaacttaagcc 179  Q
    |||||||||||||| ||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||  |||||||||| |||||||||    
52443720 ctgttgcaaaaatactgaattttttcaaataactcaacataatcaccgttaccaatgtagtcagaaatactggtgatgttagacaaaccccacttaagcc 52443819  T
180 agctaattgaatccaaattgaaaaagaacccagcataatcaccatcacccataattactt 239  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
52443820 agctaattgaatccaaattgaaaaagaacccagcataatcaccattacccataattactt 52443879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 249 - 278
Target Start/End: Original strand, 52443895 - 52443924
Alignment:
249 caattctaccatctaatttatactagtttc 278  Q
    ||||||||||||||||||||||||||||||    
52443895 caattctaccatctaatttatactagtttc 52443924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University