View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_low_44 (Length: 373)
Name: NF1297_low_44
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_low_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 80 - 239
Target Start/End: Original strand, 52443720 - 52443879
Alignment:
| Q |
80 |
ctgttgcaaaaatattgaattttttcaaataactcaacataatcattgttaccaatgtagtcagaaatactggtgatgccagacaaacccaacttaagcc |
179 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
52443720 |
ctgttgcaaaaatactgaattttttcaaataactcaacataatcaccgttaccaatgtagtcagaaatactggtgatgttagacaaaccccacttaagcc |
52443819 |
T |
 |
| Q |
180 |
agctaattgaatccaaattgaaaaagaacccagcataatcaccatcacccataattactt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52443820 |
agctaattgaatccaaattgaaaaagaacccagcataatcaccattacccataattactt |
52443879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 249 - 278
Target Start/End: Original strand, 52443895 - 52443924
Alignment:
| Q |
249 |
caattctaccatctaatttatactagtttc |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
52443895 |
caattctaccatctaatttatactagtttc |
52443924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University