View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_low_48 (Length: 351)
Name: NF1297_low_48
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_low_48 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 72 - 341
Target Start/End: Complemental strand, 36627587 - 36627319
Alignment:
| Q |
72 |
ggagcagagatttgcctgtcaagtccaggaattatctatgaaccttacgaacctcgtgagaaaatcccattttggaaaaggttaggtcgcaatggttttg |
171 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36627587 |
ggagcacagatttgcctgtcaagtccaggaattatctatgaaccttacgaacctcgtgagaaaatcccattttggaaaaggttaggtcgcaatggttttt |
36627488 |
T |
|
| Q |
172 |
tatctccattgttttagcttcttatctctattatacttttcttcttctaagtagcctnnnnnnnnnnnnnnnnntactcccatatattgttatacatgat |
271 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
36627487 |
tatctccattgttttagcttcttatatctattatacttttcttcttctaagtagcct-aaaaagaaataaaaaatactcccatatattgttttacatgat |
36627389 |
T |
|
| Q |
272 |
tcttttctctgaaatttaagttttcatatctttttgtgggatttattttaacatgaaagcagtttctgtg |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36627388 |
tcttttctctgaaatttaagttttcatatctttttgtgggatttattttaacatgaaagcagtttctgtg |
36627319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University