View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_low_49 (Length: 351)
Name: NF1297_low_49
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_low_49 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 1e-69; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 2 - 135
Target Start/End: Original strand, 34675614 - 34675747
Alignment:
| Q |
2 |
aaaattatggcatctaagattaagccacttttcttatgttgatttgcaaaatgtttccaaacaatttccctttgtatctaataataatgatatgccacct |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675614 |
aaaattatggcatctaagattaagccacttttcttatgttgatttgcaaaatgtttccaaacaatttccctttgtatctaataataatgatatgccacct |
34675713 |
T |
 |
| Q |
102 |
tgtaatttcctgtcattttgctaaacatagaaat |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34675714 |
tgtaatttcctgtcattttgctaaacatagaaat |
34675747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 132 - 260
Target Start/End: Original strand, 34675891 - 34676019
Alignment:
| Q |
132 |
aaattaccttttgcacgtagtgtatccaaatatattgctccttttgatatcatgcatgctaatttgtggtgcccttattctatcatttcaattttaggat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34675891 |
aaattaccttttgcacgtagtgtatccaaatatattgctccttttgatatcatgcatgctaatttgtggtgcccttattctatcatttcaattttgggat |
34675990 |
T |
 |
| Q |
232 |
acaaatatttctttacacgtgttgatgat |
260 |
Q |
| |
|
||||||||||| ||||||||||||||||| |
|
|
| T |
34675991 |
acaaatatttccttacacgtgttgatgat |
34676019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University