View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_low_54 (Length: 340)
Name: NF1297_low_54
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_low_54 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 77 - 245
Target Start/End: Complemental strand, 24622285 - 24622117
Alignment:
| Q |
77 |
atgaataccagatgcaacttgttctgttttagcataccccatcaaattaacatcagcagcaggaccagtaatatcatagcttccaagaccaaccaagtaa |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24622285 |
atgaataccagatgcaacttgttctgttttagcataccccatcaaattaacatcagcagcaggaccagtaatatcatagcttccaagaccaaccaagtaa |
24622186 |
T |
|
| Q |
177 |
tccgaaccgcaatccacgaccataacatcactcttcagtaacaccagtagtaacaaaatactccaaaat |
245 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24622185 |
tccgaaccgcaatccacaaccataacatcactcttcagtaacaccagtagtaacaaaatactccaaaat |
24622117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 84 - 175
Target Start/End: Complemental strand, 42398634 - 42398543
Alignment:
| Q |
84 |
ccagatgcaacttgttctgttttagcataccccatcaaattaacatcagcagcaggaccagtaatatcatagcttccaagaccaaccaagta |
175 |
Q |
| |
|
|||||||||| |||||||| |||||||| ||||||| ||||||||||| |||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
42398634 |
ccagatgcaatctgttctgtgttagcatagcccatcatgttaacatcagctgcaggaccggtaatgtcatagcttccaagaccaaccaagta |
42398543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University