View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_low_62 (Length: 319)
Name: NF1297_low_62
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_low_62 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 91 - 239
Target Start/End: Complemental strand, 40313963 - 40313815
Alignment:
| Q |
91 |
atctccacaatctattgaaatttttcagcaattcaaaattcagatagcttacaaactacataaataacatcaaaagaaattactaaaaatatccatccac |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40313963 |
atctccacaatctattgaaatttttcagcaattcaaaattcagatagcttacaaactacataaataacatcaaaagaaattactgaaaatatccatccac |
40313864 |
T |
|
| Q |
191 |
atgtcctttttaattaccttagtaggttctaaactaacaagaccacagg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40313863 |
atgtcctttttaattaccttagtaggttctaaactaacaagaccacagg |
40313815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University