View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_low_67 (Length: 312)
Name: NF1297_low_67
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_low_67 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 11 - 284
Target Start/End: Complemental strand, 9693039 - 9692766
Alignment:
| Q |
11 |
agaatatggaatcatatttctatataattgatccttccatgagcaattggatgctttgtaagctcaatagctgatctattgctcaccaataatctcatct |
110 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9693039 |
agaaaatggaatcatatttctatatatttgatccttccatgagcaattggatgctttgcaagctcaatagctgatctattgctcaccaataatctcatct |
9692940 |
T |
|
| Q |
111 |
tcttatctttattcaaattcatctcttgcatcgacatgcttaaccattatatgcaaccactgaagatgcaatgtactctacctcacaggagtataaagct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9692939 |
tcttatctttattcaaattcatctcttgcatcaacatgcttaaccattatatgcaaccactgaagatgcaatgtactctacctcacaagagtataaagct |
9692840 |
T |
|
| Q |
211 |
ataacatattccttatttgagcaccatgacattgtttcattcccataaatgaacacatatacaacaatgttttt |
284 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9692839 |
ataacacatttcttatttgagcaccatgacattgtttcattcccataaatgaacacatatacaacaatgttttt |
9692766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University