View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_low_71 (Length: 307)
Name: NF1297_low_71
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_low_71 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 87 - 297
Target Start/End: Original strand, 1713187 - 1713391
Alignment:
| Q |
87 |
tcagactcgaagccaacaatcaaattaatctaaaagacaattaattaataattgacaccatcatactccgattgtttggaatattcaagagcccgtctca |
186 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
1713187 |
tcagactcgaagccaacgatcaagctaatctaagagacaattaattaatgattgacaccatcatactccgattgtttgaaatattcaagagctcgtctca |
1713286 |
T |
|
| Q |
187 |
gggaatttgcaagttcatctatgtctattgagcaaccccctgctggaattgctcttgtcctgctagcagatgctagtgggactttttctttttagatagc |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || || ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1713287 |
aggaatttgcaagttcatctatgtctattgagcaaccccctggtg----tg--cttgttctgctagcagatgctagtgggactttttctttttagatagc |
1713380 |
T |
|
| Q |
287 |
cttttcctttg |
297 |
Q |
| |
|
||||||||||| |
|
|
| T |
1713381 |
cttttcctttg |
1713391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 1712641 - 1712710
Alignment:
| Q |
1 |
aataaaaataatgtcattagtattttattaataaatcatgtctaatatgaacacaaaaggattgtgatat |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1712641 |
aataaaaataatgtcattagtattttattaataaatcatgtctaatatgaacacgaaaggattgtgatat |
1712710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University