View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_low_73 (Length: 306)
Name: NF1297_low_73
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_low_73 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 56 - 246
Target Start/End: Original strand, 30550706 - 30550896
Alignment:
| Q |
56 |
tattacttatctgataatagatt----gctgttacaagtttacaacataaatgcaatcatatatagacattgcttaaagatcaagttttatatattgata |
151 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30550706 |
tattacttatctgataatagattaattgctgttacatgtttacaacataaatgcaatcatatatagacattgcttaaagatcaagttttatatattgata |
30550805 |
T |
 |
| Q |
152 |
aaaacattaattacaagtggaatttaattttgatcactagtatcatcatcttcttcttcagctattgaaacaatttcccctatgcctatgctact |
246 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30550806 |
aaaacatta----caagtggaatttaattttgatcactagtatcatcatcttcttcttcagctattgaaacaatttcccctatgcctctgctact |
30550896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University