View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_low_76 (Length: 301)
Name: NF1297_low_76
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_low_76 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 53 - 274
Target Start/End: Original strand, 28878216 - 28878437
Alignment:
| Q |
53 |
gttctacttatattcttaaatgcaaaggactattatttctggcaaaatgtccttgttatagattccattcatagattgagcttttgcttatttcttctac |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28878216 |
gttctacttatattcttaaatgcaaaggactattatttctggcaaaatgtccttgttatagattccattcagagattgagcttttgcttatttcttctac |
28878315 |
T |
 |
| Q |
153 |
aattttgttgccttgtgtagaggggtttataggcaaagtatattgatggagaggggacccaatattattgtggatatgaacaaagacaaagtgatttcaa |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28878316 |
aattttgttgccttgtgtagaggggtttataggcaaaggatattgatggagaggggacccaatattattgtggatatgaacaaagacaaagtgatttcaa |
28878415 |
T |
 |
| Q |
253 |
attctcaattgatttcttcatg |
274 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
28878416 |
attctcaattgatttcttcatg |
28878437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University