View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_low_78 (Length: 300)
Name: NF1297_low_78
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_low_78 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 30 - 292
Target Start/End: Complemental strand, 32988177 - 32987914
Alignment:
| Q |
30 |
caaacctgaaagacaatgttgctttcaccgttcacatcttccataaatatcaatcaataaatatatcaacctactagcatatcataacagtgagctaacc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32988177 |
caaacctgaaagacaatgttgctttcaccgtttatatcttccataaatatcaatcaaaa----tatcaacctactagcatatcataacagtgagccaacc |
32988082 |
T |
|
| Q |
130 |
aaaagaagctaaagaatacgaggtgtagt-----tttaaggttacaaatttgccatcatgctaactaagaaaacaatccacgtggtcaacaaatctatgt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32988081 |
aaaagaagctaaagaatacgaggtgtagtgtagttttaaggttacaaatttgccatcatgctaactaagaaaacaatccacatggtcaacaaatctatgt |
32987982 |
T |
|
| Q |
225 |
ctttttatcgactttccacagcttcattctccactgcttatgaacgtgctgaagtatatgttcatctc |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32987981 |
ctttttatcgactttccacagcttcattctctactgcttatgaacgtgctgaagtatatgttcttctc |
32987914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University