View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_low_81 (Length: 297)
Name: NF1297_low_81
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_low_81 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 9e-39; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 30 - 157
Target Start/End: Complemental strand, 22763201 - 22763073
Alignment:
| Q |
30 |
taatcgagatcgagcaaacacctacatcatgatcgtgcagttgcaggaaaagattattgaggtagtgacataaaacaagaaca-nnnnnnnnngggaaag |
128 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22763201 |
taatcgagatcgggcaaacaccaacatcatgatcgtgcaattgcaggaaaagattattgaggtagtgacataaaacaagaacattttttttttgggaaag |
22763102 |
T |
 |
| Q |
129 |
cataaaacaagaacatgatatcgtgttgt |
157 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22763101 |
cataaaacaagaacatgatatcgtgttgt |
22763073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 218 - 283
Target Start/End: Complemental strand, 22763013 - 22762948
Alignment:
| Q |
218 |
tgagattagtggtactacttacatttcttcatcattttgtttgttgctgaaccaacttgtgcattc |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |||||| |
|
|
| T |
22763013 |
tgagattagtggtactacttacatttcttcatcattttgtttgttgttaaaccaacttgagcattc |
22762948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University