View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_low_85 (Length: 289)
Name: NF1297_low_85
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_low_85 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 30 - 125
Target Start/End: Original strand, 8201168 - 8201263
Alignment:
| Q |
30 |
aacttagtgttctatgtgatgctaaggtttcactcatcatgttctccaaaaataacaagatgcatgaatacatcacccctggtctatcgtaagtac |
125 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8201168 |
aacttagtgttctttgtgatgctaaggtttcactcatcatgttctccaaaaataacaagatgcatgaatacatcacccctggtctctcgtaagtac |
8201263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 191 - 268
Target Start/End: Original strand, 8201330 - 8201407
Alignment:
| Q |
191 |
atattatgttacttgtgaaccagtacaaagaagattattgatcagtatcagaagactttaggggatatagatctgtgg |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8201330 |
atattatgttacttgtgaaccagtacaaagaagattattgatcagtatcagaagactttaggggatatagatctgtgg |
8201407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University