View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1298-Insertion-10 (Length: 132)
Name: NF1298-Insertion-10
Description: NF1298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1298-Insertion-10 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 61; Significance: 1e-26; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 1e-26
Query Start/End: Original strand, 53 - 132
Target Start/End: Complemental strand, 40240933 - 40240847
Alignment:
| Q |
53 |
tgtaccaaacctgcatcctggattaatacaaacacctacctagatcgatatctg-------tatatgtatctgcttgtgcaaaccga |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40240933 |
tgtaccaaacctgcatcctggattaatacaaacacctacctagatcgatatctgtataatgtatatgtatctgcttgtgcaaaccga |
40240847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University