View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1298-Insertion-11 (Length: 92)
Name: NF1298-Insertion-11
Description: NF1298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1298-Insertion-11 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 73; Significance: 6e-34; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 6e-34
Query Start/End: Original strand, 8 - 92
Target Start/End: Original strand, 33861871 - 33861954
Alignment:
| Q |
8 |
caagaagatatagagatggttccatatgcatccacaaagatagctttgtgtatgttaaggcatgcacaaggccgtatattgctca |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33861871 |
caagaagatatagagatggttccatatgcatccacaa-gatagttttgtgtatgttaaggcatgcacaaggccgtatattgctca |
33861954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 73; E-Value: 6e-34
Query Start/End: Original strand, 8 - 92
Target Start/End: Complemental strand, 33919051 - 33918968
Alignment:
| Q |
8 |
caagaagatatagagatggttccatatgcatccacaaagatagctttgtgtatgttaaggcatgcacaaggccgtatattgctca |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33919051 |
caagaagatatagagatggttccatatgcatccacaa-gatagttttgtgtatgttaaggcatgcacaaggccgtatattgctca |
33918968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University