View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1298-Insertion-13 (Length: 50)
Name: NF1298-Insertion-13
Description: NF1298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1298-Insertion-13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 42; Significance: 8e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 8e-16
Query Start/End: Original strand, 8 - 49
Target Start/End: Complemental strand, 11147636 - 11147595
Alignment:
| Q |
8 |
taatgcactctcaaaatgcttaaccaaaatttcatttttagt |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11147636 |
taatgcactctcaaaatgcttaaccaaaatttcatttttagt |
11147595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 8e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 8e-16
Query Start/End: Original strand, 8 - 49
Target Start/End: Original strand, 36768229 - 36768270
Alignment:
| Q |
8 |
taatgcactctcaaaatgcttaaccaaaatttcatttttagt |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36768229 |
taatgcactctcaaaatgcttaaccaaaatttcatttttagt |
36768270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 8e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 8e-16
Query Start/End: Original strand, 8 - 49
Target Start/End: Complemental strand, 30462613 - 30462572
Alignment:
| Q |
8 |
taatgcactctcaaaatgcttaaccaaaatttcatttttagt |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30462613 |
taatgcactctcaaaatgcttaaccaaaatttcatttttagt |
30462572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University