View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1298-Insertion-8 (Length: 112)

Name: NF1298-Insertion-8
Description: NF1298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1298-Insertion-8
NF1298-Insertion-8
[»] chr3 (1 HSPs)
chr3 (8-111)||(278111-278214)


Alignment Details
Target: chr3 (Bit Score: 96; Significance: 1e-47; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 96; E-Value: 1e-47
Query Start/End: Original strand, 8 - 111
Target Start/End: Complemental strand, 278214 - 278111
Alignment:
8 aataattgcacttgaatcatattcaacagttgttgctgatgaacaagtgtacaacaatgctaagcatgcaataagaaatgtcccaaacataggattatac 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||    
278214 aataattgcacttgaatcatattcaacagttgttgctgatgaacaagtgtacaacaatgctaagcatgcaataagaaatgtcccaaacatagcattagac 278115  T
108 atat 111  Q
    ||||    
278114 atat 278111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University