View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1298-Insertion-8 (Length: 112)
Name: NF1298-Insertion-8
Description: NF1298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1298-Insertion-8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 1e-47; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 1e-47
Query Start/End: Original strand, 8 - 111
Target Start/End: Complemental strand, 278214 - 278111
Alignment:
| Q |
8 |
aataattgcacttgaatcatattcaacagttgttgctgatgaacaagtgtacaacaatgctaagcatgcaataagaaatgtcccaaacataggattatac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
278214 |
aataattgcacttgaatcatattcaacagttgttgctgatgaacaagtgtacaacaatgctaagcatgcaataagaaatgtcccaaacatagcattagac |
278115 |
T |
|
| Q |
108 |
atat |
111 |
Q |
| |
|
|||| |
|
|
| T |
278114 |
atat |
278111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University