View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1298-Insertion-9 (Length: 137)
Name: NF1298-Insertion-9
Description: NF1298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1298-Insertion-9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 2e-62; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 2e-62
Query Start/End: Original strand, 8 - 136
Target Start/End: Original strand, 30614785 - 30614913
Alignment:
| Q |
8 |
ttttttaatagaattcctttaatttgttgttggtagcttttaaaagatctcactttaggcttataaacttgttgaatgggctttgagatggatatattat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30614785 |
ttttttaatagaattcctttaatttgttgttggtagcttttaaaagatctcactttaggcttataaacttgttgaatgggctttgagatggatatattat |
30614884 |
T |
|
| Q |
108 |
ataaagagggataactttatttatttttt |
136 |
Q |
| |
|
|||||||||||||||||| ||| |||||| |
|
|
| T |
30614885 |
ataaagagggataactttttttttttttt |
30614913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University