View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12980_high_4 (Length: 329)
Name: NF12980_high_4
Description: NF12980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12980_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 90 - 203
Target Start/End: Complemental strand, 35044655 - 35044542
Alignment:
| Q |
90 |
tattatttcttttataaaaatataacccaaataaatagcgtagaaatagggcgtctattattttttagatattcaaatgtatttatcttcttttgcaaac |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35044655 |
tattatttcttttataaaaatataacccaaataaatagcgtagaaatagggcgtcgattattttttagatattcaaatgtatttatcttcttttgcaaac |
35044556 |
T |
 |
| Q |
190 |
atattaagagaaga |
203 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
35044555 |
atattaagagaaga |
35044542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 225 - 310
Target Start/End: Complemental strand, 35044549 - 35044464
Alignment:
| Q |
225 |
agagaagagaaagtcataatctctttctctccgatggaggaggaggtgggaaggtcgtagtggcacatggttctcatacaattata |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35044549 |
agagaagagaaagtcataatctctttctctccgatggaggaggaggtgggaaggtcgtagtggcacatggttctcatacaattata |
35044464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University