View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12980_high_8 (Length: 256)
Name: NF12980_high_8
Description: NF12980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12980_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 134 - 250
Target Start/End: Complemental strand, 39055114 - 39055002
Alignment:
| Q |
134 |
ttttgtgaaataaaaataggaagtttagctatatataatttagttattttgacaaaactatctctatttttgcttatattttggttaattaaattgaatt |
233 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39055114 |
ttttgtgaaataaaaataggaagtatagctata----atttagttattttgacaaaactatctctatttttgcttatattttggttaattaaattgaatt |
39055019 |
T |
 |
| Q |
234 |
agattaggttgataatc |
250 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
39055018 |
agattaggttgataatc |
39055002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 6 - 67
Target Start/End: Complemental strand, 39055242 - 39055181
Alignment:
| Q |
6 |
aattttttatgcataagtgataaacattagttaggtattttcatttaagagtaaaagcttgt |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39055242 |
aattttttatgcataagtgataaacattagttaggtattttcatttaagagtaaaagcttgt |
39055181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University