View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12980_low_13 (Length: 239)
Name: NF12980_low_13
Description: NF12980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12980_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 46300952 - 46301166
Alignment:
| Q |
1 |
cagaaagatagctacataggcatagggataaaaacgatatttacagaatgcgagtgaaggcgcgtgagagataaataacagtgggaaatgacggcgagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46300952 |
cagaaagatagctacataggcatagggataaaaacgatatttacagcatgcgagtgaaggtgcgtgagagataaataacagtgggaaatgacggcgagaa |
46301051 |
T |
|
| Q |
101 |
catccagtataacacagtgacactcatcaaacgtcgtttcaccgccgtttcactatttctctctcttcattacacattcttctgtctttaccttacactt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46301052 |
catccagtataacacagtgacactcatcaaacgtcgtttcaccgccgtttcactatttctctctcttcattacacattcttctgtgtttaccttacactt |
46301151 |
T |
|
| Q |
201 |
cacgccaaacgcctg |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
46301152 |
cacgccaaacgcctg |
46301166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University