View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12980_low_2 (Length: 457)
Name: NF12980_low_2
Description: NF12980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12980_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 420; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 420; E-Value: 0
Query Start/End: Original strand, 19 - 438
Target Start/End: Complemental strand, 55616 - 55197
Alignment:
| Q |
19 |
ggattggcctttttctggctacattttctatggtttcagcagctgttatggagaaaaagagaagggatgcagctgtgaacctgaaccaaactctgtccat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55616 |
ggattggcctttttctggctacattttctatggtttcagcagctgttatggagaaaaagagaagggatgcagctgtgaacctgaaccaaactctgtccat |
55517 |
T |
 |
| Q |
119 |
attttggattacaccacaattcataatatttggtttgtcagagatgtttactgcagttggcctcattgagttcttctacaaacagtccttgaaagggatg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55516 |
attttggattacaccacaattcataatatttggtttgtcagagatgtttactgcagttggcctcattgagttcttctacaaacagtccttgaaagggatg |
55417 |
T |
 |
| Q |
219 |
cagacattcttcactgccatcacatattgctcctattcatttggattttatctcagctcactattggtttctttggtgaataaaatcacttcaacttcta |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55416 |
cagacattcttcactgccatcacatattgctcctattcatttggattttatctcagctcactattggtttctttggtgaataaaatcacttcaacttcta |
55317 |
T |
 |
| Q |
319 |
gtggtggtggtggttggcttcatgacaacaatctgaacaaagacaaacttgaccttttctattggttactagctgtccttagcttcctcaacttcatcaa |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55316 |
gtggtggtggtggttggcttcatgacaacaatctgaacaaagacaaacttgaccttttctattggttactagctgtccttagcttcctcaacttcatcaa |
55217 |
T |
 |
| Q |
419 |
ctatctcttctggtccagat |
438 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
55216 |
ctatctcttctggtccagat |
55197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University