View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12981_low_6 (Length: 204)

Name: NF12981_low_6
Description: NF12981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12981_low_6
NF12981_low_6
[»] chr5 (2 HSPs)
chr5 (17-141)||(18473679-18473803)
chr5 (158-190)||(18473630-18473662)


Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 17 - 141
Target Start/End: Complemental strand, 18473803 - 18473679
Alignment:
17 taaaacacgtatctatattatattaaaacgcgtatctttttctatatcaaagacagctcattaatcactataaagagagattgaagagaaatgatagttg 116  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||  |||||||| ||||||||    
18473803 taaaacacgtatctatattatattaaaacgcgtatctttttctacatcaaagacagctcattaatcactgtaaagagagatcaaagagaaaagatagttg 18473704  T
117 tacaactactcccttttttagagag 141  Q
    |||||||||||||||||||||||||    
18473703 tacaactactcccttttttagagag 18473679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 190
Target Start/End: Complemental strand, 18473662 - 18473630
Alignment:
158 gttactttggtgtgtaactgatagttacctttg 190  Q
    ||||||||||||||| |||||||||||||||||    
18473662 gttactttggtgtgtgactgatagttacctttg 18473630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University