View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12981_low_6 (Length: 204)
Name: NF12981_low_6
Description: NF12981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12981_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 17 - 141
Target Start/End: Complemental strand, 18473803 - 18473679
Alignment:
| Q |
17 |
taaaacacgtatctatattatattaaaacgcgtatctttttctatatcaaagacagctcattaatcactataaagagagattgaagagaaatgatagttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |||||||| |||||||| |
|
|
| T |
18473803 |
taaaacacgtatctatattatattaaaacgcgtatctttttctacatcaaagacagctcattaatcactgtaaagagagatcaaagagaaaagatagttg |
18473704 |
T |
 |
| Q |
117 |
tacaactactcccttttttagagag |
141 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
18473703 |
tacaactactcccttttttagagag |
18473679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 190
Target Start/End: Complemental strand, 18473662 - 18473630
Alignment:
| Q |
158 |
gttactttggtgtgtaactgatagttacctttg |
190 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
18473662 |
gttactttggtgtgtgactgatagttacctttg |
18473630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University