View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12984_high_18 (Length: 262)
Name: NF12984_high_18
Description: NF12984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12984_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 10 - 217
Target Start/End: Complemental strand, 3270276 - 3270073
Alignment:
| Q |
10 |
aagaaaatagtcatttctttttgaaaataaaccatttgatcactcaagcatcacatttatggtaatcttggttttaattcaagtttgtaaccttnnnnnn |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3270276 |
aagaaaatagtcatttctttttgaaaataaactattggatcactcaagtatcacatttatgctaatcttggttttaattcaagtttgtaacctt-aaaaa |
3270178 |
T |
|
| Q |
110 |
nnnnnncaatggnnnnnnngtttgtttcaaaagtgatgatttttgccacaaaattggtatttcctattcataatcagaattgaaattataattatcactt |
209 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3270177 |
taaatacaatggtttttttgtttgtttcaaaagtgatgatttttgccacaaaattggtatttcctattcataatcagaattgaa---ataattatcactt |
3270081 |
T |
|
| Q |
210 |
ctaagacc |
217 |
Q |
| |
|
|||||||| |
|
|
| T |
3270080 |
ctaagacc |
3270073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University