View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12984_low_12 (Length: 298)
Name: NF12984_low_12
Description: NF12984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12984_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 10 - 281
Target Start/End: Complemental strand, 41797112 - 41796841
Alignment:
| Q |
10 |
attattcttcattcctctcgggtttgttttctttgtattattgctttagttatgcatgatgcatgaatcagtactttcaaggacacaaggacggtggttt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41797112 |
attattcttcattcctctcgggtttgttttctttgtattattgctttagttatgcatgatgcatgaatcagtactttcaaggacacaaggacggtggttt |
41797013 |
T |
 |
| Q |
110 |
cttctagatgaaagatacctttaagtttagagtttagaattgggataggttgtgataggtaatccccgcattcacgcggtcggtacattggtaagtgttg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41797012 |
cttctagatgaaagatacctttaagtttagagtttagaattgggataggttgtgataggtaatccccgtattcacgcggtcggtacattggtaagtgttg |
41796913 |
T |
 |
| Q |
210 |
gaaatccattcattcatgtagttggtacataagtgattattgaatcgagacgaggcatgctatatttaaatt |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41796912 |
gaaatccattcattcatgtagttggtacataagtggttattgaatcgagatgaggcatgctatatttaaatt |
41796841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University