View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12984_low_16 (Length: 286)
Name: NF12984_low_16
Description: NF12984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12984_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-138; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 18 - 269
Target Start/End: Original strand, 27524644 - 27524895
Alignment:
| Q |
18 |
tcttttactctcactgcaactgaagttaagtgtagtggttggttgctaaagggagtacaaaatggggagaaaaaatgttggtgagatggtggtggttttg |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27524644 |
tctttcactctcactgcaactgaagttaagtgtagtggttggttgctaaagggagtacaaaatggggagaaaaaatgttggtgagatggtggtggttttg |
27524743 |
T |
 |
| Q |
118 |
gtgaccctcttgcatatttggttggtttgtgtcactgcttcatcactaggtaacatcaacaactatgaggagcatcttagaagaaaccttcttgctaatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27524744 |
gtgaccctcttgcatatttggttggtttgtgtcactgcttcatcactaggtaacatcaacaactatgaggagcatcttagaagaaaccttcttgctaatg |
27524843 |
T |
 |
| Q |
218 |
gccttggtaaaactcctcctatggggtatgtcactgaattccttctcttaat |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27524844 |
gccttggtaaaactcctcctatggggtatgtcactgaattccttctcttaat |
27524895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 99 - 269
Target Start/End: Original strand, 27530313 - 27530480
Alignment:
| Q |
99 |
tgagatggtggtggttttggtgaccctcttgcatatttggttggtttgtgtcactgcttcatcactaggtaacatcaacaactatgaggagcatcttaga |
198 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||| |||| |||||||||||||||||||| ||| |||| |||| || | ||| |||||||| ||| |
|
|
| T |
27530313 |
tgagatggtggtagttttggtgacccttttgcatgtttgtttggtttgtgtcactgcttcttcattagggaaca---actatgatggagagcatctcaga |
27530409 |
T |
 |
| Q |
199 |
agaaaccttcttgctaatggccttggtaaaactcctcctatggggtatgtcactgaattccttctcttaat |
269 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27530410 |
agaaaccttcttgctaatggacttggtaaaactcctcctatggggtatgtcactgaattccttctcttaat |
27530480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University