View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12985_high_12 (Length: 254)
Name: NF12985_high_12
Description: NF12985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12985_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 49993995 - 49994233
Alignment:
| Q |
1 |
aacaccgtacatggcaccggtgaggaagttatagaagccggtgaaaatcaaagtggtgccaaggttgaggtttttggaaagggtgagcgaaagtactatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49993995 |
aacaccgtacatggcaccggtgaggaagttatagaagccggtgaaaatcaaagtggtgccaaggttgaggtttttggaaagggtgagtgaaagtactatt |
49994094 |
T |
 |
| Q |
101 |
ggtatgtatgtgccaaggtcacccatggctccattgagttcagacaatgttgaatggaaatttaagttgnnnnnnnnnnnnngtatggtggtgagtcttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
49994095 |
ggtatgtatgtgccaaggtcacccatggctccattgagttcagataatgttgaatggaaatttaagttgttttttactttttgtatggtggtgagtcttg |
49994194 |
T |
 |
| Q |
201 |
tgggagtggtggtgggaagagtttgggggtttgatgatg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49994195 |
tgggagtggtggtgggaagagtttgggggtttgatgatg |
49994233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 95 - 160
Target Start/End: Original strand, 25800028 - 25800093
Alignment:
| Q |
95 |
actattggtatgtatgtgccaaggtcacccatggctccattgagttcagacaatgttgaatggaaa |
160 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||| ||||| | ||||| | || ||||||||||| |
|
|
| T |
25800028 |
actatgggtatgtaggtgccaaggtcacccatggcaccatttaattcagcccattttgaatggaaa |
25800093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 89 - 156
Target Start/End: Complemental strand, 1874666 - 1874599
Alignment:
| Q |
89 |
gaaagtactattggtatgtatgtgccaaggtcacccatggctccattgagttcagacaatgttgaatg |
156 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||| ||||| ||||||| | || ||||||| |
|
|
| T |
1874666 |
gaaagaactattggtatgtaggtgccaaggtcacccatggcaccatttagttcagcccattttgaatg |
1874599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University