View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12985_high_18 (Length: 215)
Name: NF12985_high_18
Description: NF12985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12985_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 65; Significance: 9e-29; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 123 - 195
Target Start/End: Original strand, 44667719 - 44667791
Alignment:
| Q |
123 |
atatcttccattaagcaatctcacctacacccacctctatatatctatacaactcttcttcctttctaatcaa |
195 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44667719 |
atatctcccattaagcaatctcacctacacccacctctatatatctatacaactcttcttcctttctagtcaa |
44667791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 22 - 86
Target Start/End: Original strand, 44667616 - 44667680
Alignment:
| Q |
22 |
attaactactgccattatttttcttatatcccctcatcactcaccacactctacaatttatcatt |
86 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44667616 |
attaactactgccattatttttcttttatcccctcatcactcaccacactctacaatttatcatt |
44667680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University