View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12985_high_5 (Length: 378)
Name: NF12985_high_5
Description: NF12985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12985_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 219
Target Start/End: Complemental strand, 3589361 - 3589160
Alignment:
| Q |
18 |
agataaaacatgttgaagagtgggaatatgtatttgtatttcgcttattaagggagttttgttctgacaaaaattgaatggatttcgcttatgctcttag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3589361 |
agataaaacatgttgaagagtgggaatatgtatttgtatttcgcttattaagggagttttgttctgacaaaaattgaatggatttcgcttatgctcttag |
3589262 |
T |
|
| Q |
118 |
ataggtgccaataatgttatgtttgattttgattttggaactattagaagacgacgtatttacgaggttgtttatagtcttgcatttctgatatcacctg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3589261 |
ataggtgccaataatgttatgtttgattttgattttggaactattagaagacgacgtatttacgaggttgtttatagtcttgcatttctgatatcacctg |
3589162 |
T |
|
| Q |
218 |
cg |
219 |
Q |
| |
|
|| |
|
|
| T |
3589161 |
cg |
3589160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 292 - 359
Target Start/End: Complemental strand, 3589079 - 3589012
Alignment:
| Q |
292 |
gttggggtggaattttacccaatgaattttcttcaacttgctggcagctataaaattaagtattagta |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3589079 |
gttggggtggaattttacccaatgaattttcttcaacttgctggcagctataaaattaagtattagta |
3589012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University