View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12985_low_18 (Length: 231)
Name: NF12985_low_18
Description: NF12985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12985_low_18 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 44 - 231
Target Start/End: Complemental strand, 47368026 - 47367839
Alignment:
| Q |
44 |
caggtttggttgatgtttagaaatatactatatgtttccttttttaactctaatttcacgttctttaattctcagtaacagaaaattatgtgaaactatt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47368026 |
caggtttggttgatgtttagaaatatactatatgtttccttttttaactctaatttcacgttctttaattctcaataacagaaaattatgtgaaactatt |
47367927 |
T |
|
| Q |
144 |
gataggattgtgcgactgcaacactttcttgtaaatgttggatagatccagtcaccacttttcctgccactgttcctgaatgtctttc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47367926 |
gataggattgtgcgactgcaacactttcttgtaaatgttggatagatccagtcaccacttttcctgccactgttcctgaatgtctttc |
47367839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 43
Target Start/End: Complemental strand, 47368295 - 47368267
Alignment:
| Q |
15 |
ttgattattttggttcaaatatatatata |
43 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47368295 |
ttgattattttggttcaaatatatatata |
47368267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University