View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12985_low_8 (Length: 338)
Name: NF12985_low_8
Description: NF12985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12985_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 54 - 328
Target Start/End: Original strand, 3588757 - 3589013
Alignment:
| Q |
54 |
gactctacctatagtttaagagagttcaagttagatttaattcgataatgtcattttcatatttgtccgacaaatattctttgttttgtcattttcttat |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3588757 |
gactctacctatagtttaagagagttcaagttagatttaattcgataatgtcattttcatatttgtccgacaaatattctttgttttgtcattttcttat |
3588856 |
T |
 |
| Q |
154 |
tgtattttatcagttgaagatacgagaccctttacctacctaatcaaccgaccaaagattgattttcattcatattaatctttgatttgaaaatggtacg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
3588857 |
tgtattttatcagttgaagatacgagaccctttacctacctaatcaaccgaccaaagattgattttcattcatattaa------------------tatg |
3588938 |
T |
 |
| Q |
254 |
tgacagtgtcatagactcatatctttaccgtaatggtagttcaatgtggctatagggttccttattcttatacta |
328 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3588939 |
tgacagtgtcatagactcatatctttaccgtaatggtagttcaatgtggctatagggttccttattcttatacta |
3589013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University